90
|
SIRION Biotech
aav6 serotype Aav6 Serotype, supplied by SIRION Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/pmc10709200-226-51-53?v=SIRION+Biotech Average 90 stars, based on 1 article reviews
aav6 serotype - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
SIRION Biotech
aav6-ef1a-shmironecut1 Aav6 Ef1a Shmironecut1, supplied by SIRION Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/pmc06160001-218-4-19?v=SIRION+Biotech Average 90 stars, based on 1 article reviews
aav6-ef1a-shmironecut1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Welgen Inc
aav2-goi-1 Aav2 Goi 1, supplied by Welgen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/pm38488707-17-29-31?v=Welgen+Inc Average 90 stars, based on 1 article reviews
aav2-goi-1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
95
|
ATCC
aspergillus oryzae cohn Aspergillus Oryzae Cohn, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/custom%401011%4038488707?v=ATCC Average 95 stars, based on 1 article reviews
aspergillus oryzae cohn - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
95
|
ATCC
aspergillus terreus thom Aspergillus Terreus Thom, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/custom%401012%4038488707?v=ATCC Average 95 stars, based on 1 article reviews
aspergillus terreus thom - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
90
|
SIRION Biotech
transgene_3′_fwd acaaccactacctgagcacc Transgene 3′ Fwd Acaaccactacctgagcacc, supplied by SIRION Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/pm38488707-39-21-51?v=SIRION+Biotech Average 90 stars, based on 1 article reviews
transgene_3′_fwd acaaccactacctgagcacc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
SIRION Biotech
transgene_3′_prob rox/cccaacgagaagcg/bhq2 Transgene 3′ Prob Rox/Cccaacgagaagcg/Bhq2, supplied by SIRION Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/pm38488707-39-28-51?v=SIRION+Biotech Average 90 stars, based on 1 article reviews
transgene_3′_prob rox/cccaacgagaagcg/bhq2 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
SIRION Biotech
paav-cmv-egfp-wpre plasmid Paav Cmv Egfp Wpre Plasmid, supplied by SIRION Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/aav6+sirion+biotech/pm38488707-39-53-57?v=SIRION+Biotech Average 90 stars, based on 1 article reviews
paav-cmv-egfp-wpre plasmid - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |